Haplogroup I-M170

From Infogalactic: the planetary knowledge core
Jump to: navigation, search

<templatestyles src="Module:Hatnote/styles.css"></templatestyles>

This article is about the human Y-DNA haplogroup. For the human mtDNA haplogroup, see Haplogroup I (mtDNA).

Lua error in package.lua at line 80: module 'strict' not found.

Haplogroup I-M170
Possible time of origin Present 31-35,000 years BP
Possible place of origin The Caucasus, Europe or South West Asia
Ancestor IJ
Descendants I*, I1, I2
Defining mutations L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK.

I-M170 is one of the most numerous haplogroups among European males.[1] Subclades can be found in most present-day European populations, with peaks in some Northern European and South East European countries. Consequently, I-M170 represents up to one-fifth of the male population of Europe, being the continent's second major Y-DNA haplogroup (behind Haplogroup R).

The haplogroup reaches its maximum frequency in the Balkans (with the highest concentration in present-day Herzegovina). It may be associated with unusually tall males, since those in the Dinaric Alps have been reported to be the tallest in the world, with an average height of 185.6 cm (6 ft 1.1 in),[2] and close to 190 cm (6 ft 3 in).[3]

While a European point of origin has often been proposed – as I-M170 has not found outside Europe in Paleolithic remains – the modern populations with the greatest proportions of basal, undiverged I* are found in the Caucasus and Iran. These include the Darginians (Dargwa) and North Ossetians of the North Caucasus,[4] and ethnic Iranians from Tehran and Isfahan.[5]

In addition, living examples of the precursor Haplogroup IJ* have been found only in Iran, among the Mazandarani and ethnic Persians from Fars.[6] This may indicate that IJ originated in South West Asia.

Origins

File:Cro-Magnon migration.gif
Spread of Cro-Magnons
European LGM refuges, 20 kya.
  Solutrean and Proto-Solutrean Cultures
  Epi-Gravettian Culture

Haplogroup IJ was in the Middle East and/or Europe about 40,000 years ago. The TMRCA (time to most recent common ancestor) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300–30,000 years ago.[7] This would make the founding event of I-M170 approximately contemporaneous with the Last Glacial Maximum (LGM), which lasted from 26,500 years ago until approximately 19,500 years ago.[8] TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago.[9] These estimates are consistent with those of Karafet 2008 cited above. However Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago.[10]

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.[11] Later the haplogroup, along with two cases of Haplogroup C, was found on human remains belonging to the culture and on individuals of the Magdalenian and Azilian cultures.[12] Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the last glacial maximum.[9]

The five known cases of Haplogroup I from Paleolithic European human remains make it the most frequent haplogroup from that period.[12] In 2016, the 31,210–34,580 year old remains of a hunter-gatherer from Paglicci Cave, Apulia, Italy were found to carry I-M170.[13] So far, only Haplogroup F* and Haplogroup C1b have been documented, once each, on older remains in Europe. I-M170 is the main haplogroup found on male remains in Mesolithic Europe, until circa 6,000 BCE.

Due to the arrival of so-called Early European Farmers, I-M170 is outnumbered by Haplogroup G among Neolithic European remains and by Haplogroup R in later remains.

The earliest documentation of I1 is from Neolithic Hungary, although it must have separated from I2 at an earlier point in time.

In one instance, haplogroup I was found far from Europe, among 2,000 year old remains from Mongolia.[14]

As of 2015 researches, the earliest light eyes and light hair of hominid (Homo Sapiens) individuals after the long extinct Neandarthals have been documented at 8,000 years old remains in Motala, Sweden, belonging to subclades of Haplogroup I2 and mitochondrial Haplogroup U5.[15][16][17] An I2a1 carrier was a carrier of red hair and others of genes of blond/light hair, while all the Motala hunter-gatherers were light skinned and blue eyed males. (Light skin genes, but not those for blonde/red hair have been found in: Siberia on a 17,000 year-old carrier of Haplogroup R*, as well as 8,000–9,000 year-old R1a remains from Karelia.)

It would seem to be that separate waves of population movement impacted Southeastern Europe. The role of the Balkans as a long-standing corridor to Europe from Anatolia and/or the Caucasus is shown by the common phylogenetic origins of both haplogroups I and J in the parent haplogroup IJ (M429). This common ancestry suggests that the subclades of IJ entered the Balkans from Anatolia or the Caucasus, some time before the Last Glacial Maximum. I and J were subsequently distributed in Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including those associated with Early European Farmers.

The existence of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported, from the Iranian plateau.[6]

File:Percentage of major Y-DNA haplogroups in Europe.png
Haplogroups in Europe

Distribution

Frequencies of Haplogroup I:

Population % hg I % hg I (Subpopulation) Sampled individuals Source
Abazinians 3.4 88 Sergeevich 2007[18]
Abkhazians 33.3 12 Nasidze Ivan 2004[19]
Adyghe (Adygea) 7 154 [20]
Adyghe (Cherkessia) 2 126 Sergeevich 2007[18]
Adyghe (Kabardia) 10 59 Nasidze Ivan 2004[19]
Afghanistan 3 (Hazara people) 60 El Sibai 2009[21]
Afghanistan 3 (Hazara), 2 (Tajiks), 0 (Pashtuns), 0 (Uzbeks), 0 (Turkmens) Di Cristofaro 2013[22]
Albanians 13 (Albania) 223 Sarno 2015
Albanians 26 (Tosk), 9 (Gheg) Ferri 2010
Albanians 22 (Tirana) 55 Battaglia 2008
Albanians 17 (Tirana) 30 Bosch 2006
Algerians 0 156 [23]
Andis 27
Armenians 5 FTDNA 2013[24]
Avars 2 115 Balanovsky
Austrians 28 50 (Vienna), 29 (Graz), 6 (Tyrol) [25]
Ashkenazi 1 1099 [26]
Azeri 3 72 Nasidze Ivan 2004
Balkars 3 135 Kutuev 2007[27]
Belarusians 23 11 (West), 15 (North), 16 (East), 28 (Centre), 30 (East Polesie), 34 (West Polesie) 565 Kushniarevich 2013
Belarusians 32 Polesie- 43 (Vichin), 12 (Avtyuki) 204 Sergeevich 2015 [28]
Bosnia and Herzegovina 53 73 (Croats), 49 (Bosniaks), 33 (Serbs) 256 Marjanovic 2006[29]
Bosnia and Herzegovina 65 Herzegovina- 71 (Mostar, Siroki Brijeg), Bosnia- 54 (Zenica) 210 Pericic 2005[30]
Bosnia and Herzegovina 73 (Croats), 45 (Bosniaks), 36 (Serbs) 255 Battaglia 2008[31]
Bulgarians 27-29 40 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo) 935 Karachanak 2009-13[32][33]
Bulgarians 34 100 Begona Martinez-Cruz 2012
Bulgaria 19 (Bulgarian Turks) 63 Zaharova 2002[34]
Central Asia 2 984 Rootsi 2004
Chechens 0 330 Balanovsky
Croats 46 1100 Mrsic 2012
Croats 44 28 (Osijek) 89 Battaglia 2008[31]
Croats 66 (Hvar),54 (Korcula), 55 (Brac), 28 (Krk) Barac 2003[35]
Cyprus 1 164 El-Sibai 2009[36]
Czechs 18 25 (Klatovy), 25 (Pisek), 15 (Brno) 14 (Hradec[disambiguation needed]), 10 (Trebic) 257 Luca 2007[37]
Danes 39 194 Rootsi 2004
Darginians 58 26 Nasidze Ivan 2004
Darginians (Kaitak) 0 101
Dutch 33 410 Van Doorn 2008[38]
Egyptians 0 124 El-Sibai 2009[39]
Egyptians 1 370 [23]
Estonians 19 194 Rootsi 2004
English 18 945 Rootsi 2004
English 26 12 (Cornwall), 38 (Essex) 1830 FTDNA 2016[40]
Estonians 17 118 Lappalainen 2008[41]
Flemish Belgians 28 113 [42]
Finland 29 52 (Satakunta), 47 (Ostrobothnia), 36 (Swedes from Ostrobothnia), 15 (Northern Savo) 536 Lappalainen 2008[43]
French 16 (South), 24 (Normandy), 4 (Lyon), 4 (Corsica) Rootsi 2004
French 9 5 (Auvergne), 13 (Brittany), 9 (Nord Pas de Calais) 555 Luis-Ramos 2008[44]
French 13 11 (Paris), 18 (Strasburg), 10 (Lyon) 333 Kari Hauhio[25]
Gagauzes 28 89 Varzari 2006
Georgians 0 63 Rootsi 2004
Georgians 4 77 Nasidze Ivan 2004
Germans 24 32 (Berlin), 32 (Hamburg), 15 (Leipzig) 1215 Kayser 2005[45]
Greeks 14 30 (Macedonia) 261 Rootsi 2004
Greeks 10 (Athens), 30 (Macedonia) 149 Battaglia 2008
Greeks 36 (Serres), 24 (Agrinio), 20 (Thessaloniki), 18 (Mytilene), 14 (Crete), 14 (Larissa), 11 (Patrai), 12 (Karditsa), 8 (Ioannina), 2 (Chios) 366 Di Giacommo 2003[46]
Greeks 12 (North), 24 (South) 142 Zalloua 2008
Greenlanders 17 215 Sanchez 2004[47]
Hungarians 23 162 Rootsi 2004
Hungarians 28 230 Vago Zalan Andrea 2008
Indians 0 (North India) 560 [48]
Ingush 0 143
Iranians 2 22 (South Iran), 5 (Khorasan), 0 (Teheran) 186 Di Cristofaro 2013[22]
Iranians 1 (West), 1 (East) 324 [49]
Iranians 0 83 Rootsi 2004
Iranians 1 92 El-Sibai 2009[36]
Iranians 0 6 (Armenians of Teheran), 0 (Persians of Teheran, Fars, Isfahan, Khorasan, Yazd) 952 Grugni 2012
Iraqis 1 176 Rootsi 2004[50]
Iraqis 1 117 El-Sibai 2009[36]
Irish 11 76 Rootsi 2004
Irish 10 119 Cappeli 2013[51]
Irish 11 (Rush, Dublin) Capelli 2003
Italians 5 (North), 7 (Central), 9 (Sicily), 39 (Sardinia) Rootsi 2004
Italians 10 31 (Sardinia), 4 (Umbria, Marche) 884 Boattini 2013[52]
Italians 7 0 (Calabria, Pescara, Garfognana, Val di Non), 5 (Verona), 7(Genoa), 19 (Foggia) 524 Di Giacommo 2003[53]
Italians 36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra) Messina 2015[54]
Italians 23 (Udine), 17 (Saniti), 13 (Picenium), 7 (Latini) 583 Brisighelli 2012[55]
Italians 30 (Stelvio) [56]
Italians 31 (Caccamo) Gaetano 2008[57]
Jordanians 1 273 El-Sibai 2009[36]
Jordanians 5 (Amman), 0 (Dead Sea) 146 Flores 2005[58]
Kara Nogays 13 76
Karachays 9 69 Sergeevich 2007[18]
Kazakhs 1 370 [59]
Kosovar Albanians 8 114 Pericic 2005
Kumyks 0 73 Kutuev 2007[27]
Kurds 4 (West Iran) 21 Malyarchuk 2013[60]
Kurds 2 (Iran) 59 Gragni 2012
Kurmanji 17 (Turkey), 0 (Georgia) 112 Nasidze 2005[61]
Kuwaiti 0 42 El-Sibai 2009[36]
Kyrgyzstan 0 (Uyghurs), 0 (Kyrgyz) Di Cristofaro 2013[22]
Laks 14 [62]
Latvians 9 3 (Southwest) [63]
Lebanese 3 10 (North Marionite), 0 (Shia) 951 [36][64]
Lebanese 5 66 Rootsi 2004
Lezgis 0 81
Lithuanians 7 Kushniarevich 2015
Libyans 0 83 [23]
Libyans 2 1 175 Fendri 2015[65]
Macedonians 34 (Skopje) 79 Pericic 2005
Macedonia 24 31 (Macedonians), 12 (Albanians) 343 Noevski 2010
Macedonia 13 (Albanians) 64 Battaglia 2008[31]
Maltese 12 90 El-Sibai 2009[36]
Moldovans 29 (Moldovans), 25 (Ukrainians) Varzari 2006
Moroccans 0 316 El-Sibai 2009[36]
Moroccans 0 760 [23]
Mongols 1 160 Di Cristofaro 2013[22]
Norwegians 45 906 FTDNA[66]
Norwegians 37 40 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen) Dupuy 2005
Pakistan 0 638 [67]
Poles 17 19 (Warsaw), 12 (Lublin), 22 (Szczecin) 913 Kayser 2005
Poles 18 191 Rootsi 2004
Portuguese 5 303 Rootsi 2004
Portuguese 8 3 (Lisboa), 0 (Setubal), 18 (Braga) 657 Beleza 2005[68]
Qatar 0 72 El-Sibai 2009[36]
Romani 17 (Hungary), 10 (Tiszavasvari), 5 (Tokaj) 37 (Taktakoz), 11 (Slovakia) Vago Zalan Andrea 2008
Romanians 28 36 (Brasov), 18 (Cluj) 178 Martinez-Cruz 2012[69]
Romanians 22 361 Rootsi 2004
Russians 13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen) 1228 Balanovsky 2008
Russia 2 (Udmurts), 5 (Pinega), 5 (Komi), 5 (Tatars), 6 (Bashkortostan), 19 (Kostroma), 11 (Chuvashes), 11 (Smolensk), 17 (Belgorod), 19 (Mordvins), 23 (Cossacks), 24 (Adygea) Rootsi 2004
Saami 31 Rootsi 2004
Saudis 0 1597 [70]
Scotland 11 17 (Scottish Isles) Rootsi 2004
Sephardi 4 (Portugal) 57 [71]
Serbs 36 (Belgrade) 113 Pericic2005[30]
Serbs 41 (Aleksandrovac) 85
Serbs 39 267 Todorovic 2013[72]
Slovakians 28 250 Petrejcikova 2013[73]
Slovenians 30 57 (Spodnjeposavska) 458 Vakar 2010[74]
Spaniards 6 18 (Asturias), 0 (Gascony) 1002 Adams 2008[75]
Sudanese 5 (Nubians), 4 (Gaalien), 7 (Mesereia) [76]
Swedes 42 32 (Ostergotaland & Jonkoping) 50 (Gotland & Varmland) 305 Karlsson2006[77]
Swedes 26 (North Sweden),[78] Rootsi2004
Swedes 41 (South), 26 (North) Rootsi 2004
Swedes 44 60 (Kristianstad), 60 (Kalmar), 59 (Kronoberg), 55 (Stockholm), 37 (North Norrland), 52 (South Norrland) 1800 FTDNA 2016[79]
Swiss 8 144 Rootsi 2004
Swiss 23 13 (Lausanne), 32 (Bern) [25]
Syrians 2 (West), 3 (East) 520 [49]
Syrians 2 554 El Sibai 2009[36]
Tataers 33 (China) 33 [80]
Tunisians 0 El-Sibai 2009[36]
Tunisians 0 601 [23]
Turks 5 12 (Marmara), 10 (Istanbul), 7 (Western Anatolia), 4 (Central Anatolia), 0 (Eastern Anatolia ) 523 Cinnioglu 2003
Turks 5 741 Rootsi 2004
UAE 0 164 El-Sibai 2009[36]
Ukrainians 22 585 Rootsi 2004
Ukrainians 28 33 (Sumy), 23 (Ivano-Frankivsk) 701 Kushniarevich 2013
Welsh 8 196 Rootsi 2004
Yemenese 0 62 El-Sibai 2009[36]
Zazas 33 (Turkey) 27 Nasidze 2005[61]
17 (Albanians in Tirana), 29 (Macedonians in Skopje), 21 (Aromanians in Krusevo), 19 (Greeks in Thrace), 42 (Aromanians in Andon Poci), 42 (Romanians in Constanta), 39 (Romanians in Piotesti) Bosch 2006[81]
47 (Romanians from Buhusi and Piatra-Neamt), 35 (Moldovans from Sofia), 24 (Moldovans from Karasahani) 24 (Gagauzes from Etulia), 31 (Gagauzes from Kongaz), 25 (Ukrainians from Rashkovo) Vazari 2006
38 (Sweden), 41 (Western Finland), 28 (Eastern Finland), 18 (Karelia), 12 (Lithuania), 7 (Latvia), 17 (Estonia) Lappalainen2008[82]
34 (Iranians from Teheran), 10 (Iranians from Isfahan), 32 (Ossetians from Ardon), 13 (Ossetians from Digora) Nasidze Ivan. 2004[19]
3 (Tajiks) 3 (East Persians) Malyarchuk 2013[83]
2 (Kizhi), 4 (Teleuts), 4 (Khakassians), 3 (Todjins), 2 (Evenks) 3 (Tofalars), 1 (Tuvinians)

Subgroups

The subclades of Haplogroup I-M170 with their defining mutations:[84]

  • I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179) Middle East, Caucasus, Europe.
    • I-M253 Haplogroup I1 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253,M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe In Anatolia at 1%[85]
    • I1 L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187, L840, M253, M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111
      • I1a DF29/S438
        • I1a1 CTS6364/Z2336
          • I1a1a M227
            • I1a1a1 M72
          • I1a1b L22/S142
            • I1a1b1 P109
            • I1a1b2 L205
            • I1a1b3 L287
              • I1a1b3a L258/S335
                • I1a1b3a1 L296
            • I1a1b4 L300/S241
            • I1a1b5 L813/Z719
        • I1a2 S244/Z58
          • I1a2a S246/Z59
            • I1a2a1 S337/Z60, S439/Z61, Z62
              • I1a2a1a Z140, Z141
                • I1a2a1a1 Z2535
                  • I1a2a1a1a L338
                • I1a2a1a2 F2642
              • I1a2a1b Z73
              • I1a2a1c L573
              • I1a2a1d L1248
                • I1a2a1d1 L803
            • I1a2a2 Z382
          • I1a2b S296/Z138, Z139
            • I1a2b1 Z2541
        • I1a3 S243/Z63
          • I1a3a L1237
      • I1b Z131 [86]
  • I2 L68/PF3781/S329, M438/P215/PF3853/S31
    • I2a L460/PF3647/S238
      • I2a1 P37.2
        • I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056
          • I2a1a1 L160/PF4013
        • I2a1b L178/S328, M423
          • I2a1b1 M359.2/P41.2
          • I2a1b2 L161.1/S185
          • I2a1b3 L621/S392
            • I2a1b3a L147.2
        • I2a1c L233/S183
      • I2a2 L35/PF3862/S150, L37/PF6900/S153, L181, M436/P214/PF3856/S33, P216/PF3855/S30, P217/PF3854/S23, P218/S32
        • I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77
          • I2a2a1 CTS616, CTS9183
            • I2a2a1a M284
              • I2a2a1a1 L1195
                • I2a2a1a1a L126/S165, L137/S166, L369
                • I2a2a1a1b L1193
            • I2a2a1b L701, L702
              • I2a2a1b1 P78
              • I2a2a1b2 L699, L703
                • I2a2a1b2a L704
            • I2a2a1c Z161
              • I2a2a1c1 L801/S390
                • I2a2a1c1a CTS1977
                  • I2a2a1c1a1 P95
                • I2a2a1c1b CTS6433
                  • I2a2a1c1b1 Z78
                    • I2a2a1c1b1a L1198
                      • I2a2a1c1b1a1 Z190
                        • I2a2a1c1b1a1a S434/Z79
              • I2a2a1c2 L623, L147.4
            • I2a2a1d L1229
              • I2a2a1d1 Z2054
                • I2a2a1d1a L812/S391
              • I2a2a1d2 L1230
          • I2a2a2 L1228
        • I2a2b L38/S154, L39/S155, L40/S156, L65.1/S159.1, L272.3
          • I2a2b1 L533
    • I2b L415, L416, L417
    • I2c L596/PF6907/S292, L597/S333

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..

I-M170

The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several I* individuals, who do not fall into any known subclades, have been found among the Lak people of Dagestan, at a rate of (3/21),[87] as well as Turkey (8/741), Adygea in the Caucasus (2/138) and Iraq (1/176), even though I-M170 occurs at only very low frequencies among modern populations of these regions as a whole. This is consistent with the belief that the haplogroup first appeared in South West Eurasia.

There are also high frequencies of Haplogroup I* among the Andalusians (3/103), French (4/179), Slovenians (2/55), Tabassarans (1/30),[87] and Saami (1/35).[88]

(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.)

A living Hazara male from Afghanistan has also been found to carry I*, with all known subclades of both I1 (M253) and I2 (M438) ruled out.[89]

I1-M253

<templatestyles src="Module:Hatnote/styles.css"></templatestyles>

Main article: Haplogroup I1 (Y-DNA)

Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I1-M253 is closely correlated with that of Haplogroup I2a2-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I-M170 Y-chromosomes are I1-M253. Another characteristic of the Scandinavian I1-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations.

I2-M438

<templatestyles src="Module:Hatnote/styles.css"></templatestyles>

Main article: Haplogroup I-M438

Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.

I2a1a-M26

Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the Sardinians, and I2a1a-M26 is the predominant type of I among them.

Haplogroup I2a1a-M26 is practically absent east of France and Italy,[90] while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile-León, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I2a1a-M26 appears to be the only subclade of Haplogroup I-M170 found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques.[citation needed] The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[90]

The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[90]

I2a1b-M423

Haplogroup I2a1b-M423 is the most frequent Y-chromosome Haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50-60%[30]) and Bosnia-Herzegovina (up to 71%,[91] avg. 40-50%[30]). A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I2a1b-M423 is virtually absent in Fennoscandia, Western and Southwestern Europe.

I2a2-M436

The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.[92]

Haplogroup I2a2-M436 also occurs among approximately 1% of Sardinians, and in Hazaras from Afghanistan at 3%.[93]

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

See also

References

  1. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  2. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  3. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  4. ↑ Laura Caciagli, 2009, "The key role of patrilineal inheritance in shaping the genetic variation of Dagestan highlanders", Journal of Human Genetics, no. 54 (13 November), pp. 689–694.
  5. ↑ Ivan Nasidze et al., 2006, "Concomitant Replacement of Language and mtDNA in South Caspian Populations of Iran", Current Biology, no. 16 (April 4), pp. 668–673.
  6. ↑ 6.0 6.1 Lua error in package.lua at line 80: module 'strict' not found.
  7. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  8. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  9. ↑ 9.0 9.1 Lua error in package.lua at line 80: module 'strict' not found.
  10. ↑ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. pp. 33-42.
  11. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  12. ↑ 12.0 12.1 Lua error in package.lua at line 80: module 'strict' not found.
  13. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  14. ↑ Lua error in package.lua at line 80: module 'strict' not found.[dead link]
  15. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  16. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  17. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  18. ↑ 18.0 18.1 18.2 ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
  19. ↑ 19.0 19.1 19.2 Lua error in package.lua at line 80: module 'strict' not found.
  20. ↑ Yunusbayev 2011
  21. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  22. ↑ 22.0 22.1 22.2 22.3 Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
  23. ↑ 23.0 23.1 23.2 23.3 23.4 Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  24. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  25. ↑ 25.0 25.1 25.2 [1]
  26. ↑ [2]
  27. ↑ 27.0 27.1 Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
  28. ↑ ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ [3]
  29. ↑ Marjanovic 2006
  30. ↑ 30.0 30.1 30.2 30.3 Lua error in package.lua at line 80: module 'strict' not found.
  31. ↑ 31.0 31.1 31.2 Lua error in package.lua at line 80: module 'strict' not found.
  32. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  33. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  34. ↑ [4]
  35. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  36. ↑ 36.00 36.01 36.02 36.03 36.04 36.05 36.06 36.07 36.08 36.09 36.10 36.11 36.12 Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  37. ↑ Y-chromosomal variation in the Czech Republic
  38. ↑ ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief
  39. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  40. ↑ https://s-media-cache-ak0.pinimg.com/originals/d1/09/43/d109434a9e66aad55a8b10c4677dbba3.png
  41. ↑ Migration Eaves to the Baltic Region
  42. ↑ http://www.jogg.info/32/mertens.htm
  43. ↑ Regional differences among the Finns: A Y-chromosomal perspective
  44. ↑ Phylogeography of French male lineages
  45. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  46. ↑ https://www.familytreedna.com/pdf/italy.pdf
  47. ↑ Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis
  48. ↑ Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
  49. ↑ 49.0 49.1 Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
  50. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  51. ↑ A Y Chromosome Census of the British Isles
  52. ↑ Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
  53. ↑ Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
  54. ↑ Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
  55. ↑ Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
  56. ↑ Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
  57. ↑ Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
  58. ↑ Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
  59. ↑ Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
  60. ↑ Y chromosomes in Iranians and Tajiks
  61. ↑ 61.0 61.1 MtDNA and Y-chromosome Variation in Kurdish Groups
  62. ↑ The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
  63. ↑ Pliss et. al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
  64. ↑ Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
  65. ↑ Paternal lineages in Libya inferred from Y-chromosome haplogroups
  66. ↑ https://docs.google.com/spreadsheets/d/1YzT09-z3NodQSBcHNhcty6KQw6DQNLCKKaUZQTojIRA/edit#gid=1132979062
  67. ↑ Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
  68. ↑ Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
  69. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  70. ↑ Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
  71. ↑ Phylogeographic analysis of paternal lineages in NE Portuguese Jewish communities
  72. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  73. ↑ The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
  74. ↑ ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
  75. ↑ Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
  76. ↑ Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
  77. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  78. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  79. ↑ [5]
  80. ↑ Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
  81. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  82. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  83. ↑ Y chromosomes in Iranians and Tajiks
  84. ↑ ISOGG 2011
  85. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  86. ↑ http://isogg.org/tree/ISOGG_HapgrpI.html
  87. ↑ 87.0 87.1 Lua error in package.lua at line 80: module 'strict' not found.
  88. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  89. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  90. ↑ 90.0 90.1 90.2 Lua error in package.lua at line 80: module 'strict' not found.
  91. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  92. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  93. ↑ Lua error in package.lua at line 80: module 'strict' not found.
Notes

External links

Phylogenetic tree and distribution maps

Projects

Other

Evolutionary tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1[χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1 F2 F3 GHIJK
G HIJK
H IJK
IJ K
I J LT [χ 5]  K2
L T NO [χ 6] K2b [χ 7]   K2c K2d K2e [χ 8]
N O K2b1 [χ 9]    P
M S [χ 10] Q R
  1. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
  7. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  8. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
  9. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
  10. ↑ Haplogroup S (S-M230) was previously known as Haplogroup K5.
Retrieved from "https://infogalactic.com/w/index.php?title=Haplogroup_I-M170&oldid=724684394"